Advancing knowledge of viral diseases to strengthen surveillance, preparedness, and public health response in Laos
The Medical Entomology and Vector-Borne Disease Laboratory at the Institut Pasteur du Laos (IPL) is among the leading vector research laboratories in Laos and Southeast Asia. The laboratory focuses on identifying and characterizing both common and emerging vector-borne pathogens to understand their ecological distribution, host relationships, and the influence of environmental and climatic factors on disease transmission.
Our Team
Executive summary
The Medical Entomology and Vector-Borne Disease Laboratory at the Institut Pasteur du Laos (IPL) is among the leading vector research laboratories in Laos and Southeast Asia. The laboratory focuses on identifying and characterizing both common and emerging vector-borne pathogens to understand their ecological distribution, host relationships, and the influence of environmental and climatic factors on disease transmission.
Our research covers a wide range of arthropod vectors—including ticks, chigger mites, mosquitoes, sandflies, bat flies etc.—and emphasizes the importance of accurate vector taxonomy. We combine classical morphological identification with modern molecular and genomic approaches to ensure reliable species classification and to detect both known and previously unrecognized pathogens. Using pan-genus molecular assays and Next Generation Sequencing (NGS), including the locally implemented Microseek pipeline for virus discovery, the laboratory has strengthened its capacity to conduct comprehensive virome and pathogen surveillance directly in Laos.
Since 2024, IPL has made significant progress in strengthening its local capacity for NGS and bioinformatics. The successful transfer and implementation of the Microseek pipeline from Institut Pasteur Paris now allow in-country viral metagenomic analysis, enabling comprehensive virus discovery and virome profiling to be conducted directly at IPL. This achievement represents a major milestone toward sustainable genomic surveillance and the early detection of emerging vector-borne and other infectious pathogens in Laos.
The 2024–2025 research activities highlight a multidisciplinary and collaborative effort to advance vector and pathogen studies across Laos.
Project 1 – Ectoparasite and Pathogen Surveillance in Laos: In partnership with NAMRU-INDOPACIFIC (Singapore), surveillance from 2024–2025 revealed high diversity among Haemaphysalis, Dermacentor, and Rhipicephalus ticks, particularly in Phongsaly Province. Although no Flavi- or Phleboviruses were detected by PCR, high infection rates with Rickettsia (46%) and Ehrlichia/Anaplasma (34%) highlight widespread bacterial circulation in northern Laos among tick vectors.
Project 2 – NGS-Based Detection of Biothreat Agents and Arboviruses: Using the NGS platform, NGS analysis of ticks, mosquitoes, and sandflies revealed over 127 virus families in tick samples, including key families such as Chuviridae, Phenuiviridae, Rhabdoviridae, Flaviviridae, and Orthomyxoviridae. Thirteen complete flavivirus genomes were identified from mosquitoes, and nine phlebovirus genomes from sandflies, including continued detection of Laotian phlebovirus 1 (LPV1). These findings underscore the extensive virome diversity and the importance of integrated ecological and genomic monitoring.
Project 3 – Climate Change and Tick-Borne Pathogens in Northern Laos: Supported by the Grand Challenges Pasteur Network, this project investigates how temperature and humidity patterns shape tick abundance and infection rates in Phongsaly Province. Preliminary findings show clear seasonal variation, with high Rickettsia (45%) and Ehrlichia positivity in Rhipicephalus microplus and Ixodes ticks. The introduction of a Knowledge, Attitudes, and Practices (KAP) survey will provide additional social insights to guide community-based prevention strategies.
In addition to research, the laboratory remains committed to capacity building, offering hands-on training for Lao students and young scientists in entomology, molecular diagnostics, and bioinformatics.
Through these integrated approaches, the Medical Entomology and Vector-Borne Disease Laboratory contributes critical data and technical expertise for integrated vector–pathogen–host surveillance and emerging pathogen preparedness in Laos and across the region.
Plain language summary
The Medical Entomology and Vector-Borne Disease Laboratory at the Institut Pasteur du Laos (IPL) studies insects and other small arthropods that can transmit diseases between animals and humans. These include ticks, mosquitoes, sandflies, mites, bat flies etc. Our goal is to understand where these vectors are found, what pathogens they carry, and how environmental and climate changes affect their populations and disease risks.
A key part of our work is vector taxonomy—the science of identifying and classifying vectors. Correct identification is essential because different species can transmit different pathogens. By combining traditional morphology (examining their morphological characteristics under a microscope) with modern molecular tools, we can accurately identify both known and previously unrecognized species. This information helps us monitor biodiversity and predict which species may pose a higher risk for disease transmission.
We also use molecular techniques and Next Generation Sequencing (NGS) to detect both known and novel viruses and bacteria. In recent years, IPL has significantly increased its capacity for genomic analysis through the successful implementation of the Microseek pipeline for virus discovery. This allows our team to conduct advanced bioinformatic analyses from insect vectors directly in Laos—an important step toward sustainable, in-country pathogen surveillance.
Our recent findings include:
- A wide variety of tick species in northern Laos, many carrying bacteria such as Rickettsia and Ehrlichia.
- Detection of over 127 viral families in samples from ticks, mosquitoes, and sandflies, including viruses related to Flaviviridae, Chuviridae, and Phenuiviridae.
- Clear seasonal patterns in tick activity influenced by temperature and humidity, showing how climate affects vector populations.
Beyond research, the laboratory provides training and mentorship for Lao students and young scientists, helping to build national expertise in entomology, molecular biology, and emerging disease surveillance. Together, these efforts strengthen integrated health monitoring and early detection systems to reduce the impact of vector-borne and zoonotic diseases in Laos.
Projects
Ectoparasite and pathogen surveillance in Laos
- The Naval Medical Research Unit-IDOPACIFIC (NAMRU-INDOPACIFIC)
NAMRU-INDOPACIFIC in support of the Department of Defense Global Emerging Infections Surveillance and Response System (DoD-GEIS)
- Survey and modern identification of indigenous ticks and other associated arthropod species distribution.
- Collection, identification, and extraction of vector DNA for submission and development of a regional repository.
- Detection of putative pathogens associated with ectoparasites from Laos.
- Building local capacities and competencies.
Vector-borne diseases pose a significant risk of infectious disease to deployed military personnel and local populations. In Laos, definitive diagnosis is often not available for vector-borne illnesses, so the infectious diseases that are a threat to military and civilian populations are not well-defined. To identify common and emerging vector-borne pathogens in Laos, NAMRU-2 Singapore (SG) established a study to assess the distribution and infection potential of vectors (including ticks and associated arthropods). In this study, ticks and associated arthropod vectors were surveyed from the environment and their associated hosts to provide biological specimens for diagnostic purposes. The samples were transported to the Institut du Pasteur (IPL) laboratory in Vientiane, where a wide range of diagnostic tests were performed to identify both the vector and pathogens with which they may be infected. In order to understand the infectious disease threats in a range of environments in Laos, IPL collected and screened specimens from 2 sites and 2 provinces throughout Laos.
Field site and times
We conducted two field ectoparasite collection missions in each province for our main tasks during the course of this project from September 2024 to August 2025: (1) Namtha District, Luangnamtha Province, in December 2024 and March 2025, and (2) Bounneua District, Phongsaly Province, in February and May 2025. Additionally, an optional field collection was carried out in June 2025 in Viengphoukha District, Luangnamtha Province (Fig. 1).
Field collection procedure
Ectoparasites
Tick dragging/flagging: Tick dragnets were swept/dragged along the forest ground at approximately 1–2 m intervals before being examined for ticks. Ticks were removed from the sheets using forceps, then transferred to 1.5 mL labeled cryotubes..
Small Mammal Trapping: In each study site, 50 Sherman traps (baited with bananas, sweet potatoes, or grain cereal) were placed in the format of a transect according to the topography in a plantation or forest.
Additional tick collection was carried out by examining domestic animals (cattle). The animal owners were asked to help examine their animals. Once ticks attached to animals were found, they were collected by direct hand removal.
All samples were stored at -20°C in the field and transported to IPL’s laboratory using dry ice.
Hematophagous insects
CDC light traps were used to collect hematophagous insects. The traps were placed at different habitats, including chicken coops, pig houses, cow houses, goat houses, rabbit houses, caves, and in a karstic limestone area located between the two villages (Nam-Ang and Phoulan village). Traps were set between 17:00 and 18:00 and operated until 07:00–08:00 the following day. All specimens were then stored in a portable freezer at –20 °C for approximately 12–24 hours before sorting and identification.
Laboratory work
Ectoparasite identification
Ticks were identified and grouped under microscopes in cooling conditions (on ice packs) by using reference determination from Dr. Richard G. Robbins of the US Armed Forces Pest Management Board (AFPMB), together with related references from Southeast Asia, Japan, Korea, the Ryukyu Islands (Yamaguti, Tipton et al. 1972), L. E. Robinson keys for genus Amblyomma (Nuttall, Cooper et al.), and keys from Thailand (Tanskull and Inlao 1989) for adult Haemaphysalis ticks. As there are no morphological identification keys available for pre-imago forms, all larval and nymph stages were grouped into genus. After tick identification and pooling, all tick samples were stored at −80°C at IPL for further analysis.
Chigger mites from rodents were mounted on slides using PVA mounting medium. Mite samples were identified using a compound microscope to genus level by referring to the published taxonomic key of Nadchatram & Dohany 1974.
Mosquitoes were identified under a stereo-microscope using related identification keys (Rattanarithikul R., et al. 2005, 2006, 2010). As Sandflies and Culicoides were collected and stored immediately in liquid nitrogen for virus detection and isolation, the specimens were not morphologically identified.
Sample preparation and RNA/DNA extraction
Samples were pooled from 1-10 ticks/ectoparasites according to collection source, species, development stage, blood meal, and site.
For the hematophagous insects, mosquitoes of the same species from the same site were grouped into 1–6 samples to form a “mini pool”. Sandflies and Culicoides specimens were not morphologically identified and were placed into tubes numbered 1–6 and 15–25, respectively. Subsequently, all samples were rapidly transferred to liquid nitrogen to maintain optimal preservation conditions for the next step.
All of the pools were extracted as the following procedure: Specimens were placed in 1.5 mL vials containing 1 mL of 1X cold Phosphate Buffered Saline (PBS) and Lysing Matrix A zirconium beads (MP Biomedicals). Tick pools were homogenized for 10 min at a vibration frequency of 25/s in a TissueLyser II system (Qiagen). After grinding, beads and tissues were spun down by centrifugation for 5 min at 3000 rpm. To obtain total nucleic acid (both DNA and RNA) for bacterial and viral detection by polymerase chain reaction (PCR), 100 μl of each pool was extracted and purified by using NucleoSpin 8 Virus extraction kit following the manufacturer’s protocol. The remaining 400 μl of each pool was stored at –80°C for future pathogen isolation.
Arbovirus screening at IPL
Extracted samples were initially screened for phleboviruses and flaviviruses by RT-PCR (Fig. 2) as previously described by Sanchez-Seco et al., 2003 and 2005.
In parallel with generic screening of phleboviruses, specific primers and probe designed for SFTSV detection (S-segment), previously described by Sun Y., et al. 2012, were also used for tick screening.
Fig. 2: Lab work procedure at IP-Laos.
Bacteria screening at IPL
To investigate the occurrence of Rickettsia spp. (spotted fever group) in ticks, a molecular screening approach targeting the 17kDa gene (Jiang et al. 2004) was implemented at IPL. Samples were also screened for the detection of Ehrlichia spp. To identify bacteria to the species level, 17kDa, Sca4, and ompA genes were amplified for Rickettsia spp. (Spotted fever group); groEL, and gltA were amplified for Ehrlichia spp. (Tab. 2) before Sanger sequencing as previously described by Taylor et al., 2016.
Tab. 2: Primers used for bacteria screening and species identification.
Bacterium | Gene | Forward/Revers | (5’-3’) |
Rickettsia spp. (Spotted fever group) | 17kDa | F | GGGCGGTATGAAYAAACAAG |
R | CCTACACCTACTCCVACAAG | ||
Probe | CCGAATTGAGAACCAAGTAATGC | ||
17kDa | F1 | CATTGTCCGTCAGGTTGGCG | |
R1 | GGAACACTTCTTGGCGGTG | ||
F2 | AACCGTAATTGCCGTTATCCGG | ||
R2 | GCATTACTTGGTTCTCAATTCGG | ||
Sca4 | F1 | TGGTAGCATTAAAAGCTGATGG | |
F2 | ATTTATACACTTGCGGTAACAC | ||
R | TCTAAATKCTGCTGMATCAAT | ||
ompA | F1 | TTGCGTTATAACACTTTTTAAGTGA | |
F2 | ATGGCGAATATTTCTCCAAAA | ||
R1 | ATTACCTATTGTTCCGTTAATGGCA | ||
R2 | GTTCCGTTAATGGCAGCATCT | ||
Ehrlichia spp. | 16S rRNA | F | GCGGCAAGCCTAACACAT |
R | CCCGTCTGCCACTAACAATTATT | ||
Probe | AGTCGAACGGACAATTGCTTATAACCTTTTGGT | ||
groEL | F1 | GAAGATGCWGTWGGWTGTACKGC | |
R1 | AGMGCTTCWCCTTCWACRTCYTC | ||
F2 | ATTACTCAGAGTGCTTCTCARTG | ||
R2 | TGCATACCRTCAGTYTTTTCAAC | ||
gltA | F1 | GGRRTRTTAACTTATGATCCAGG | |
R1 | GCATTYTGYTCATGATCAGCATG | ||
F2 | TTATGTCTACTGCTGCTTGTGA | ||
R2 | TARGAAGAAAYRTCAAACATCATATG |
A total of 8,163 ticks and other ectoparasites were collected from two provinces, of which 4,843 were from Phongsaly, and 3,320 were from Luangnamtha. Ticks were classified into 19 species of 5 genera including A. testudinarium, A. varanense, D. auratus, D. bellulus, D. sp. near to D. bellulus, D. spp., D. steini, D. sp. near to D. steni, D. tamokensis, H. aborensis, H. hystricis, H. quadriaculeata, H. spp., I. granulatus, I. spp., R. haemaphysaloides, R. microplus, R. sanguineus, and R. spp. (See Tab. 2 for more detail). A total of 3,630/5,691 ticks were collected from vegetation by dragging (Tab. 3).
Table 3: A total number of ectoparasites collected from two sites: Bounneua and Namtha districts.
Family | Genus | Species | Luangnamtha | Phongsaly | Total | |
Dermanyssidae | Unidentified | Unidentified | 440 | 1,370 | 1,810 | |
Haematopinidae | Unidentified | Unidentified | 92 | 216 | 308 | |
Ixodidae | Amblyomma | A. testudinarium | 71 | 707 | 778 | |
A. varanense | 3 | 3 | ||||
Dermacentor | D. auratus | 23 | 4 | 27 | ||
D. bellulus | 3 | 1 | 4 | |||
D. spp. | 28 | 15 | 43 | |||
D. sp. near to D. bellulus | 2 | 2 | ||||
D. sp. near to D. steni | 1 | 1 | ||||
D. steini | 1 | 1 | ||||
D. tamokensis | 4 | 4 | ||||
Haemaphysalis | H. aborensis | 1 | 1 | |||
H. hystricis | 78 | 11 | 89 | |||
H. quadriaculeata | 2 | 2 | ||||
H. spp. | 45 | 54 | 99 | |||
Ixodes | I. granulatus | 22 | 11 | 33 | ||
I. spp. | 41 | 14 | 55 | |||
Rhipicephalus | R. haemaphysaloides | 19 | 368 | 387 | ||
R. microplus | 1,891 | 96 | 1,987 | |||
R. sanguineus | 1 | 1 | ||||
R. spp. | 300 | 1,874 | 2,174 | |||
Laelapidae | Echinolaelaps | Unidentified | 157 | 84 | 241 | |
Pulicidae | Unidentified | Unidentified | 95 | 18 | 113 | |
Grand Total | 3,320 | 4,843 | 8,163 |
Family | Genus | Species | Source | Grand Total | ||||||
Animal | Dragging | |||||||||
Buffalo | Cow | Dog | Goat | Poultry | Rodent | Vegetation | ||||
Dermanyssidae | Unidentified | Unidentified |
|
|
|
| 1,810 |
|
| 1,810 |
Haematopinidae | Unidentified | Unidentified | 286 | 22 |
|
|
|
|
| 308 |
Ixodidae | Amblyomma | A. testudinarium | 52 | 13 | 713 | 778 | ||||
A. varanense | 3 | 3 | ||||||||
Dermacentor | D. auratus | 27 | 27 | |||||||
D. bellulus | 4 | 4 | ||||||||
D. spp. | 5 | 38 | 43 | |||||||
D. sp. near to D. bellulus | 2 | 2 | ||||||||
D. sp. near to D. steni | 1 | 1 | ||||||||
D. steini | 1 | 1 | ||||||||
D. tamokensis | 4 | 4 | ||||||||
Haemaphysalis | H. aborensis | 1 | 1 | |||||||
H. hystricis | 1 | 1 | 8 | 79 | 89 | |||||
H. quadriaculeata | 2 | 2 | ||||||||
H. spp. | 6 | 93 | 99 | |||||||
Ixodes | I. granulatus | 2 | 31 | 33 | ||||||
I. spp. | 1 | 15 | 39 | 55 | ||||||
Rhipicephalus | R. haemaphysaloides | 25 | 109 | 10 | 8 | 235 | 387 | |||
R. microplus | 47 | 1,695 | 23 | 1 | 221 | 1,987 | ||||
R. sanguineus | 1 | 1 | ||||||||
R. spp. | 2,172 | 2,174 | ||||||||
Ixodidae | 125 | 1,823 | 50 | 9 | 52 | 3,630 | 5,691 | |||
Laelapidae | Echinolaelaps | Unidentified | 2 | 241 |
| 241 | ||||
Pulicidae | Unidentified | Unidentified | 13 | 92 | 8 | 113 | ||||
Grand Total |
|
| 413 | 1,858 | 142 | 9 | 1,810 | 293 | 3,638 | 8,163 |
Tab. 4: Total number of ectoparasites identified from different sites, methods of collection, and sources.
A total of 814 sandflies were collected, with the highest numbers at the cave entrance (431), the karstic area (181), and the goat house (86). Additionally, 240 Culicoides midges were collected, most abundantly at the goat house (105) and the pig house (55), as shown in Tab. 5. A total of 117 mosquito specimens were collected and classified into four genera: Aedes, Anopheles, Culex, and Armigeres. The greatest number of mosquitoes (64) was captured at the cave entrance, followed by the karstic area (18) and the pig house (17). Uranotaenia spp. was the most abundant species (47), followed by Culex nigropunctatus (18), and Anopheles spp. (10), as shown in (Tab. 6).
Tab 5: Number of samples categorized by sample type at each site.
Habitat | Nam Eng village | Phoulan village | Viengkham | Total | ||||
Culicoides | Mosquitoes | Sandflies | Culicoides | Mosquitoes | Sandflies | Mosquitoes | ||
Cave entrance | 64 | 431 | 6 | 501 | ||||
Cow House | 20 | 20 | ||||||
Goat House | 105 | 8 | 86 | 199 | ||||
Hotel room | 2 | 2 | ||||||
In the Cave | 1 | 31 | 4 | 36 | ||||
Karstic area | 6 | 32 | 12 | 149 | 199 | |||
Pig House | 55 | 8 | 6 | 9 | 35 | 113 | ||
Rabbit house | 40 | 1 | 40 | 81 | ||||
Grand Total | 180 | 79 | 500 | 40 | 36 | 314 | 2 | 1,151 |
Tab 6: Number of mosquito species categorized by each site.
Species | Cave entrance | Goat House | Hotel room | In the Cave | Karstic area | Pig House | Rabbit house | Total |
Ae. spp. | 1 | 2 | 1 | 4 | ||||
An. spp. | 2 | 1 | 2 | 5 | 10 | |||
Ar. spp. | 4 | 1 | 1 | 6 | ||||
Cx. bitaeniarhynchus | 1 | 1 | ||||||
Cx. hutchinsoni | 2 | 2 | ||||||
Cx. nigropunctatus | 16 | 2 | 18 | |||||
Cx. spp. | 2 | 2 | 2 | 6 | ||||
Cx. vishnui | 2 | 6 | 8 | |||||
Ur. spp. | 35 | 1 | 8 | 2 | 1 | 47 | ||
Not determination | 14 | 1 | 15 | |||||
Grand Total | 70 | 8 | 2 | 1 | 18 | 17 | 1 | 117 |
A total of 3,284 ectoparasite samples were pooled into 1,443 mini-pools, from which DNA and RNA were extracted. These mini-pools were further combined into 184 big-pools and screened for Pan-Flaviviruses and Pan-Phleboviruses using conventional PCR; all results were negative. The characterization of the mini-pools is shown in Table 7 below. A subset of 103 big-pool samples was screened for specific SFTSV using real-time PCR, and all results were negative (see Fig. 3).
Fig. 3: Real-time RT-PCR screening for SFTSV.
Tab 7: Total number and characterization of ectoparasite mini-pools screened for Pan-Flaviviruses and Pan-Phleboviruses.
Family | Genus | Development stage | A total No. of Pools (No. of samples) | Province | Pan-Flavivirus Positive | Pan-Phlebovirus Positive | ||
Luangnamtha | Phongsaly | |||||||
A total No. of Pools (No. of samples) | A total No. of Pools (No. of samples) | |||||||
Dermanyssidae | Not determine | Not determine | 46 (650) | 19 (380) | 27 (270) | 0 | 0 | |
Ixodidae | Amblyomma | Adult | 35 (41) | 2 (2) | 33 (39) | 0 | 0 | |
Nymph | 151 (424) | 44 (44) | 107 (380) | 0 | 0 | |||
Dermacentor | Adult | 12 (12) | 8 (8) | 4 (4) | 0 | 0 | ||
Larvae | 3 (11) | 3 (11) | () | 0 | 0 | |||
Nymph | 23 (25) | 10 (10) | 13 (15) | 0 | 0 | |||
Haemaphysalis | Adult | 46 (46) | 38 (38) | 8 (8) | 0 | 0 | ||
Larvae | 3 (18) | 3 (18) | () | 0 | 0 | |||
Nymph | 34 (45) | 14 (14) | 20 (31) | 0 | 0 | |||
Ixodes | Adult | 11 (11) | 9 (9) | 2 (2) | 0 | 0 | ||
Larvae | 20 (43) | 8 (31) | 12 (12) | 0 | 0 | |||
Nymph | 13 (13) | 13 (13) | () | 0 | 0 | |||
Rhipicephalus | Adult | 809 (814) | 553 (553) | 256 (261) | 0 | 0 | ||
Larvae | 133 (1019) | 17 (222) | 116 (797) | 0 | 0 | |||
| Nymph | 104 (112) | 94 (95) | 10 (17) | 0 | 0 | ||
Grand Total |
| 1,443 (3,284) | 835 (1,448) | 608 (1,836) | 0 | 0 | ||
A total of 342 pools (813 samples: 416 sandflies, 277 mosquitoes, and 120 Culicoides) were screened for Pan-Flaviviruses, and Pan-Phleboviruses using nested RT-PCR. Of these, one pool originating from Culex vishnui tested positive for Pan-Flaviviruses, and three pools originating from sandflies tested positive for Pan-Phleboviruses, while all Culicoides samples tested negative (Tab. 8). Follow-up NGS for full genome sequencing of these positive samples is ongoing.
Tab 8: Total number of hematophagous insect pools screened for Pan-Alphaviruses, Pan-Flaviviruses and Pan-Phleboviruses.
Family | A total No. of Pools (No. of samples) | Pan-Flavi Positive | Pan-Phlebo Positive |
A total No. of Pools (No. of samples) | A total No. of Pools (No. of samples) | ||
Culicidae | 231 (277) | 1 (2) | 0 |
Culicoides | 6 (120) | 0 | 0 |
Sandfly | 105 (416) | 0 | 3 (12) |
Grand Total | 342 (813) | 1 (2) | 3 (12) |
To continue our activities from 2024, for rickettsia screening, the ectoparasite samples from animals and vegetation in Khammouane and Vientiane provinces, previously collected and stored at −80°C in the IPL freezer, were included in rickettsia screening during this report from 2024 -2025. Additional samples collected in 2025 from Luangnamtha and Phongsaly provinces, as the collection results above were also included.
A total of 1,014 minipools, comprising 1,669 ticks, were screened for Rickettsia spp. (spotted fever group) using real-time PCR. Of these, 46% (468 pools, containing 826 ticks) tested positive (see Tab. 9).
Tab 9: Total number of ectoparasites in mini pools and screened for SFGR at IPL.
Province/Source | Pan- Rickettsia (17 kDa) | ||
Total No. of Pools (No. of ticks) | No. of Positive Pools (No. of ticks) | Percentage of Pool Positive | |
Khammuane | |||
Animal | 56 (56) | 22 (22) | 39.29 |
Luangnamtha | |||
Animal | 369 (369) | 252 (252) | 68.29 |
Dragging | 102 (250) | 25 (153) | 24.51 |
Trapping | 12 (12) | 5 (5) | 41.67 |
Phongsaly | |||
Animal | 234 (348) | 133 (237) | 56.84 |
Dragging | 169 (562) | 18 (144) | 10.65 |
Trapping | 17 (17) | 6 (6) | 35.29 |
Vientiane province | |||
Animal | 51 (51) | 5 (5) | 9.80 |
Human Bitten | 4 (4) | 2 (2) | 50.00 |
Grand Total | 1,014 (1,669) | 468 (826) | 46.15 |
To identify positive samples at the species level, we amplified and performed Sanger sequencing of three specific genes, including 17kDa gene (110 samples), OmpA gene (100 samples), and Sca4 gene (84 samples). Analysis of these sequences identified 5 species of Spotted Fever Group Rickettsia as Candidatus Rickettsia jingxinensis, Candidatus Rickettsia laoensis, Rickettsia honei, Rickettsia sp. Clade 1, and Rickettsia sp. Clade 2.
Real-time PCR primers and probes were used to detect Ehrlichia spp. in tick samples. A total of 116 minipools, comprising 123 ticks (34% of the screened pools), tested positive (see Tab. 10).
To identify positive samples at the species level, we amplified and performed Sanger sequencing on two specific genes: the groEL gene (52 samples), and the gltA gene (65 samples). Although the real-time PCR assay was designed to detect Ehrlichia species, sequencing of the groEL gene revealed both Ehrlichia and Anaplasma species. Sequence analysis identified five species: Ehrlichia sp. Clade 1, Ehrlichia minasensis, Ehrlichia sp. Clade 2, Ehrlichia sp. Clade 3, and Anaplasma marginale. Additionally, an Anaplasma sp. Clade 1 was identified.
Tab 10: Total number of ticks in mini pools screened for Ehrlichia spp.
Province/Source | Ehrlichia spp. | ||
Total No. of Pools (No. of ticks) | No. of Positive Pools (No. of ticks) | Percentage of Pool Positive | |
Khammuan | |||
Animal | 56 (56) | 13 (13) | 23.21 |
Luangnamtha | |||
Animal | 199 (199) | 80 (80) | 40.20 |
Dragging | 18 (18) | 3 (3) | 16.67 |
Phongsaly | |||
Animal | 16 (31) | 9 (16) | 56.25 |
Vientiane | |||
Animal | 51 (51) | 11 (11) | 21.57 |
Grand Total | 340 (355) | 116 (123) | 34.12 |
The ectoparasite collections conducted between 2024 and 2025 revealed high diversity and abundance, particularly among Haemaphysalis, Dermacentor, and Rhipicephalus species. Tick populations were higher in Phongsaly than in Luangnamtha, likely reflecting ecological differences such as vegetation type, host availability, and altitude.
Although viral screening by PCR did not detect Flaviviruses or Phleboviruses, upcoming NGS analyses (see next section) will provide deeper insights into viral diversity. In contrast, high positivity rates for Rickettsia (46%) and Ehrlichia/Anaplasma (34%) indicate widespread bacterial infections, including Candidatus R. laoensis, R. honei, E. minasensis, and A. marginale.
These findings establish essential baseline data on ectoparasite ecology and pathogen circulation in northern Laos. Continued longitudinal and metagenomic surveillance, integrated with climatic and host data, will be critical for understanding disease dynamics and guiding One Health-based vector control and early warning systems.
Jiang J., Chan T., Temenek J.J., Dasch G.A., Ching W. and Richards A.L. (2004). Development of a Quantitative Real-Time Polymerase Chain Reaction Assay Specific for Orientia tsutsugamushi. American Journal of Tropical Medicine and Hygiene, 70(4): 351-356
Lewis, D. J. Lewis, D J. 1982. “A taxonomic review of the genus Phlebotomus (Diptera: Psychodidae).” Bulletin of the British Museum (Natural History) Entomology 45, 121–209. Bulletin of the British Museum (Natural History) Entomology vol. 45 121–209.
Nadchatram, M. and A. L. Dohany. 1974. A pictorial key to the subfamilies, genera and subgenera of Southeast Asian chiggers (Acari, Prostigmata, Trombiculidae). Bulletin from the Institute for Medical Research Federation of Malaysia, 16: 1–67.
Nuttall, G. H. F., W. F. Cooper, C. Warburton, L. E. Robinson, and D. R. Arthur. 1926. Ticks: pt. IV. The genus Amblyomma. Cambridge University Press.
Quate LW. A REVIEW OF THE INDO-CHINESE PHLEBOTOMINAE ( Diptera : Psychodidae ). 4, (1962).
Rattanarithikul R, Harbach RE, et al. Illustrated keys to the mosquitoes of Thailand. II. Genera Culex and Lutzia. Southeast Asian J. Trop. Med. Public Health 36 Suppl 2, 1–97 (2005).
Rattanarithikul R, Harbach RE, et al. Illustrated keys to the mosquitoes of Thailand V. Genera Orthopodomyia, Kimia, Malaya, Topomyia, Tripteroides, and Toxorhynchites. Southeast Asian J. Trop. Med. public Heal. 38 Suppl 2, 1–65 (2007).
Rattanarithikul R, Harrison BA, et al. Illustrated keys to the mosquitoes of Thailand I. Background; geographic distribution; lists of genera, subgenera, and species; and a key to the genera. Southeast Asian J. Trop. Med. public Heal. 36 Suppl 1, 1–80 (2005).
Rattanarithikul R, Harrison BA, et al. Illustrated keys to the mosquitoes of Thailand III. Genera Aedeomyia, Ficalbia, Mimomyia, Hodgesia, Coquillettidia, Mansonia, and Uranotaenia. Southeast Asian J. Trop. Med. Public Health 37 Suppl 1, 1–85 (2006).
Rattanarithikul R, Harrison BA, et al. Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J. Trop. Med. Public Health 37 Suppl 2, 1–128 (2006).
Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J. Trop. Med. Public Health 41 Suppl 1, 1–225 (2010).
Sánchez-Seco, M. P. et al. Detection and identification of Toscana and other phleboviruses by RT-nested-PCR assays with degenerated primers. J. Med. Virol. 71, 140–149 (2003).
Sánchez-Seco, M. P. et al. Generic RT-nested-PCR for detection of flaviviruses using degenerated primers and internal control followed by sequencing for specific identification. J. Virol. Methods 126, 101–109 (2005).
Tanskull, P. and I. Inlao. 1989. Keys to the adult ticks of Haemaphysalis Koch, 1844, in Thailand with notes on changes in taxonomy (Acari: Ixodoidea: Ixodidae). J Med Entomol 26(6): 573–600.
Yamaguti N., V. J. Tipton, H. L. Keegan, and S. Toshioka (1971). Ticks of Japan, Korea, and the Ryukyu islands. Brigham Young University Science Bulletin, Biological Series 15(1):1.
Sequence-based detection of biothreat agents and arboviruses in Laos
- The NAMRU-INDOPACIFIC
- The Bioinformatics & Biostatistics Hub, Institut Pasteur Paris (IPP)-France
- NAMRU-INDOPACIFIC in support of the Department of Defense Global Emerging Infections Surveillance and Response System (DoD-GEIS), MERSI24
- Institut Pasteur du Laos Foundation (Young Researcher Grant Challenge 2023)
- Fonds Equipe France, French Embassy in Laos (PIMES project)
- To characterize the virome of ticks and other arthropod vectors in Laos.
- To strengthen the local capacity for NGS-based surveillance of vector-borne pathogens in Laos.
- To generate datasets for future analyses of interactions among ticks, tick-borne pathogens, and microbiota, to improve strategies for the control of ticks and tick-borne infections in humans and animals.
Emerging and re-emerging diseases throughout the Indo-Pacific region continue to be of great concern during this time of rapid population growth, increasing urbanization, extensive air travel, environmental changes, and the lack of effective intervention strategies. It is of vital importance to understand the arboviral and vector-borne pathogens’ circulation throughout these regions as well as their potential for dissemination to other regions of the world. Biothreat agents have great harm potential for warfighters, especially when syndrome-based diagnostics can significantly delay correct etiology identification. As such, there is an urgent need to establish and maintain a surveillance network in strategic locations that will lead to early recognition of emerging pathogens to implement intervention measures to minimize the impact on human health.
The Institut Pasteur du Laos, is uniquely positioned to serve as the implementing contractor because: (1) has access to the previously collected entomological samples; (2) has the expertise and logistics capabilities at the reference laboratories to conduct the detailed genomics laboratory analyses, and (3) has the resources and expertise needed to conduct characterization and description of the infectious agents from genomics data resulting from the NGS analysis.
Since 2012, in collaboration with NAMRU-2, the Institut Pasteur du Laos (IPL) has surveyed over 30,000 ticks across ten provinces of Laos: Bokeo (BK), Bolikhamxay (BKX), Khammouane (KM), Luangphabang (LPB), Luangnamtha (LNT), Oudomxai (ODX), Phongsaly (PSL), Vientiane Province (VTP), Xayaboury (XYR), and Xiengkhouang (XK). Alongside targeted molecular screening for known human pathogens such as SFTSV, TBEV, and Rickettsia (Spotted Fever Group), a meta-transcriptomic NGS approach was employed to detect a broader range of emerging or zoonotic arboviruses that may be overlooked by conventional assays and to characterize tick virome diversity.
A total of 129 tick pools were previously analyzed: 12 from Xiengkhouang (2020), nine from Oudomxai (2021), 22 from Luangnamtha – Viengphoukha District (2022), 23 from Bolikhamxay, and eight from Phongsaly – Bouneu District (2023), and 31 from Luangnamtha – Long District, 23 from Phongsaly – Khua District, and one from Vientiane Province (2024) (Fig. 4).
However, due to limited funding in earlier studies, sample pools were often too large (>20 individuals), potentially leading to misinterpretation of virome diversity. In the present study, additional tick samples collected from Luangnamtha and Phongsaly provinces during 2024–2025 were selected for NGS analysis following these criteria:
- Single (non-pooled) specimens
- Different provinces
- Different genera or species
- Different developmental stages
- Different hosts
In addition, mosquito, sandfly, and other insect samples were included to provide a broader overview of arthropod-associated virome diversity.
Fig. 4: Map represents collection sites where tick sample pools were submitted for NGS analysis.
The total DNA/RNA from selected tick samples was extracted. The quality and concentration of extracted samples were evaluated using Agilent TapeStation and Qubit 2.0 Fluorometer (Invitrogen, USA), respectively. Total RNA libraries were constructed using the SMARTer Stranded Total RNA-seq Kit v3-Pico input mammalian (TaKaRa). DNA library quality and concentration were evaluated using the same techniques mentioned above. Then the libraries were sent to Macrogen Asia Pacific Pte. Ltd. for NGS using the NovaSeq6000 platform at 20Gb/sample.
The Microseek bioinformatic pipeline was successfully installed on the IPL server. It is a pipeline oriented initially for pathogen discovery, but that can also efficiently detect already known viruses (see https://pubmed.ncbi.nlm.nih.gov/36146797/). Briefly, after quality check and trimming of raw reads, de novo assembly of reads was performed using Megahit, and the resulting contigs and singletons were translated into protein sequences across all six reading frames using an in-house program. Sequences shorter than 15 amino acids were removed, and taxonomic assignment of all sequences was performed using DIAMOND and Blast tools with three successive databases: i) a reference viral protein database, RVDB-prot 29; ii) a generalist protein database, NCBI/nr, and iii) a generalist nucleotide database, NCBI/nt (Fig. 5). For each taxonomic assignment, the abundance of a given taxonomic unit was quantified by summing the nucleotide lengths of the corresponding matching sequences. Specifically, for individual reads, this was calculated as the cumulative length of the reads. For contigs, the abundance was determined by multiplying the contig length by its estimated coverage, as computed by the sequence assembler.
Fig. 5: summary of Microseek pipeline (see https://pubmed.ncbi.nlm.nih.gov/36146797/).
Contigs of interesting viruses were filtered and extracted from Microseek results (webpage interface). The open reading frames (ORFs) of each sequence were identified using standalone version of NCBI’s ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/). ORFs were also predicted using Prokka and imported to Geneious prime software for manual observation. Amino acids of CDSs were blasted, and selected sequences from NCBI were downloaded for analysis. Sequences alignment and removal of ambiguously aligned regions were performed using MAFFT and BMGE, respectively. The maximum-likelihood trees were constructed using IQ-TREE version 2.3.6 with 1000 ultrafast bootstrap replicates. The best-fit model of substitution was identified using ModelFinder. The curated amino acid alignments were used for calculating the distance matrix in the software MEGA v12.
All describing data of viral families, genera, and species relative abundances were analyzed and visualized in R software (v4.2.1).
As shown in Fig. 4, between 2019 and 2025, a total of 307 samples were submitted for NGS analysis, with a marked increase in submissions from 2023 onward. Tick samples represented the majority across all years, reflecting the main focus of our ongoing tick-borne disease surveillance. In 2024 and 2025, the range of sample types expanded to include sandflies, mosquitoes, mixed insect pools, Culicoides, and environmental samples (Env), demonstrating our effort to diversify vector and environmental monitoring activities.
The number of samples increased from 12 in 2019 to 117 in 2024 and 116 in 2025, showing the growth of our sequencing capacity recently following the implementation of the NGS platform at IPL (Fig. 6).
Fig. 6: Total number and characteristics of samples submitted to NGS by year between 2019 and 2025.
For the years 2024–2025, a total of 233 libraries from various arthropod and environmental samples were prepared for NGS analysis using Microseek pipeline. In 2024, all libraries were completed analysis. In 2025, 85 libraries have been completed, while 31 are still ongoing (Tab. 11).
Tab. 11: A total number and characteristics of samples that conducted NGS and analysis using Microseek pipeline.
Sample type | Years | Microseek_run | Number of Library | |
Done | On going | |||
Culicoides | 2025 | 6 | 6 | |
Env | 2025 | 4 | 4 | |
Mix_Insect | 2025 | 6 | 6 | |
Mosquito | 2024 | 27 | 27 | |
2025 | 10 | 10 | ||
Sandfly | 2024 | 8 | 8 | |
2025 | 10 | 10 | ||
Tick | 2019 | 12 | 12 | |
2021 | 9 | 9 | ||
2022 | 22 | 22 | ||
2023 | 31 | 31 | ||
2024 | 82 | 82 | ||
2025 | 53 | 27 | 80 | |
Grand Total |
| 276 | 31 | 307 |
While awaiting the ongoing analysis of the remaining samples, we present here an updated summary of all tick NGS data, comprising 161 samples (3,116 individual ticks) collected from six provinces between 2019 and 2025. Preliminary analyses revealed that the Shannon diversity indices of the virome varied among ticks within the same genus (Fig. 7). This variation may reflect differences in the sources of tick collection, which were found to be statistically significant (Fig. 8).
In total, more than 127 viral families were classified by NGS. Red stars in Fig. 9 indicate families of particular interest, including Chuviridae, Phenuiviridae, Rhabdoviridae, Flaviviridae, and Orthomyxoviridae. Further analyses will be conducted upon completion of the remaining sample processing.
Fig. 7: Shannon diversity indices of the virome among tick genera.
Fig. 8: Shannon diversity indices of the virome among different tick sources.
Fig. 9: Virus families classified by NGS from 161 tick samples.
Up to the present, analysis of 37 mosquito libraries revealed 13 complete flavivirus CDSs derived from different mosquito species. Among these, one was phylogenetically related to known mosquito-borne flaviviruses, while the remaining 12 clustered within the group of insect-specific flaviviruses (Fig. 10).
Fig. 10: Maximum likelihood phylogenetic tree of full CDSs (aa) of flaviviruses detected in mosquitoes in Laos.
Since the initial detection of phleboviruses from sandflies in Laos in 2022, ongoing surveillance has been conducted intermittently at the same collection sites. During 2024–2025, nine additional complete coding sequences (CDSs) were obtained by next-generation sequencing (NGS) from sandflies collected in northern Laos. Phylogenetic analysis revealed that all newly identified sequences clustered with those previously reported in Laos, tentatively named Laotian phlebovirus 1 (LPV1) (Fig. 11).
Fig. 11: Maximum likelihood phylogenetic tree of full CDSs (aa) of the L-segment of phleboviruses found from sandflies in Laos between 2022 and 2025. Reds represent samples detected in 2022, blues in 2024, and greens in 2025.
Our ongoing NGS-based surveillance of arthropod vectors in Laos has revealed a broad diversity of viruses across multiple taxa. In ticks, analysis of 161 samples (3,116 individuals) collected between 2019 and 2025 identified more than 127 virus families. Differences in Shannon diversity indices among ticks of the same genus suggest that ecological conditions, host preferences, and collection sources may influence virus diversity. Notably, several virus families of interest were detected and need more in-depth analysis, including Chuviridae, Phenuiviridae, Rhabdoviridae, Flaviviridae, and Orthomyxoviridae.
Among mosquito-derived libraries (n = 37), 13 complete flavivirus CDSs were recovered. One was phylogenetically related to known mosquito-borne flaviviruses, while the remaining twelve clustered within insect-specific flaviviruses, indicating extensive virus diversification within local mosquito populations. In sandflies, nine additional complete phlebovirus CDSs were obtained between 2024 and 2025, all clustering with the previously described Laotian phlebovirus 1 (LPV1), confirming its continued circulation in northern Laos.
Together, these findings provide an updated overview of the virome landscape in hematophagous arthropods of Laos. Continued analysis of the remaining samples and integration of the data generated with ecological and climatic data will be essential for assessing virus–vector–environment interactions and enhancing early detection of emerging vector-borne pathogens in the region.
Climate change impacts on ticks and tick-related pathogens in Lao PDR
Grand Challenges / Pasteur Network
This study aims to assess how climate and environmental changes affect ticks and tick-borne pathogens in Lao PDR, integrating a Knowledge, Attitudes, and Practices (KAP) study to understand community awareness and behaviors related to tick and other vector-borne diseases.
Specific Objectives :
- To compile an inventory of pathogens associated with ticks and other arthropod vectors in the study areas.
- To investigate the effects of climate and microclimate on tick populations and tick-borne pathogens in Lao PDR.
- To develop and implement KAP surveys to assess community awareness and exposure risks to tick and other vector-borne diseases.
- To generate data supporting the development of national and regional surveillance systems for tick-borne diseases.
The Lao People’s Democratic Republic (Lao PDR) is a predominantly rural landlocked country surrounded by Thailand, Myanmar, China, Vietnam, and Cambodia. Laos ranks 138 in the world by the UNDP Human Development Report1. Vector-borne diseases constitute a significant infectious disease risk for local populations. In Lao PDR, definitive diagnosis is often not available for vector-borne illnesses, so the infectious diseases that are a threat to the population are not well-defined.
Lao PDR is a highly mountainous country, with elevations frequently above 500 meters. The tropical monsoon climate produces a significant rainy season that lasts from May until October. From November to February, there is a cooler, dry season, which is then followed by a hot, dry season in March and April. There is a broad range of temperatures across the country, as areas along the Mekong River can reach 41° C during the hot season, or as low as 5°C during the cold season in the Northern parts of the country.
It is well known that warming temperature affects the behavior, physiology, and life history of vectors, pathogens, and hosts. The interactions between temperature, vector, host, and pathogen can change the risk of spillover events from natural reservoir hosts to humans. Ticks are well known as vectors of viral, bacterial, and protozoa diseases. One of the good examples of climate change impacting tick-borne disease expansions in humans is Lyme disease. Since the first description of this disease, both the number and geographical range of human cases have increased and seem to be linked with temperature warming trends. It is well documented in the laboratory that Ixodes ticks, the vector of Lyme disease, adapt their “questing” behavior (host seeking by climbing up vegetation and waiting to grab on to a passing host) according to the climate changes (temperature and humidity). However, there are no field investigations to explore the impact of microclimate or regional climate changes on the dynamics of tick vectors and tick-borne pathogens in Southeast Asia in general, and Lao PDR in particular.
Microclimate and regional climate changes may impact the dynamics of tick vectors and their related pathogens, and increase the risk of human exposure to these pathogens in Lao PDR, as well as in the Southeast Asian region. IPL has experience in ticks and tick-borne pathogens study; however, because of budget limitations, IPL has never been able to conduct a longitudinal surveillance in a specific area in order to assess the impact of microclimate or regional climate changes on the tick population and diversity, as well as on their related pathogens. This project aims to study the climate change impacts on ticks and tick-related pathogens in Lao PDR to model the transmission dynamics of tick-borne diseases and support the development of a country-wide and/or regional surveillance system to prevent the spread of these vector-borne diseases in the human population, especially in the poor and rural areas that are more at risk.
During previous projects funded by The Global Emerging Infections Surveillance (GEIS) via the US Naval Medical Research Unit-2 (GEIS-NAMRU-2) since 2012 to present, the Institut Pasteur du Laos has collected over 17,000 individual ticks in Lao PDR. This collection includes approximately 27 different species, including 14 new records for Laos and one new species to science2,3,4. In addition, via these projects, a number of pathogens of potential public health importance carried by ticks and other ectoparasites have been discovered in Lao PDR thanks to a collaborative effort involving IPL, the Lao-Oxford-Mahosot Hospital-Wellcome Trust Research Unit (LOMWRU), and the Pathogen Discovery Laboratory at Intitut Pasteur (Paris). The list of pathogens found in ticks includes several arboviruses (Dabieshan Tick virus, Lihan Tick virus and Jingmen Tick virus5) as well as various Rickettsia (Anaplasma phagocytophilum, Rickettsia bovis, R. helvetica, R. japonica, R. massilae, R. raoultii, R. tamurae, Candidatus Rickettsia laoensis, Candidatus Rickettsia mahosotii, and Candidatus Rickettsia khammouanensis6). Yet the significance of most of these pathogens remains largely unknown. This lack of information on the basic biology of vector-borne diseases in Lao PDR as well as SE-Asia, is of great concern. There are recent examples of the emergence of tick-borne viruses in SE-Asia: the Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) was first reported in China in 20077, and later reported in Japan, Korea, and Vietnam in patients with severe fever, thrombocytopenia, and leukocytopenia8-10. As Lao PDR is a landlocked country bordered by China and Vietnam, we hypothesize that this tick-borne virus, as well as potentially other unknown arboviruses of public health concern, may circulate in Lao PDR, but are currently underestimated because of inadequate clinical training, limited surveillance and laboratory capacity.
Study design:
- Two-year longitudinal surveillance of ticks and their related pathogens in the northern region of Lao PDR.
- A cross-sectional study conducted to assess the knowledge, attitudes, and practices (KAP) of rural communities regarding ticks and other vector-borne diseases, in conjunction with ecological/pathogen monitoring of vectors and climate variables in Lao PDR.
Selection of sites:
Four villages in Khua District, Phongsaly Province (Fig. 12)—where previous laboratory surveillance of ticks and tick-borne pathogens was conducted—were selected as study sites for both entomological and KAP surveys.
Fig. 12: Sampling sites in Khua district, Phongsaly province (northern Laos)
Study subjects:
- Vectors: Ticks and other arthropod vectors.
- Human participants: Residents from selected villages meeting the inclusion criteria for the KAP survey.
Field vector collection procedure
Tick dragging/flagging: Tick dragnets (1 m² white flannel cloths) were dragged slowly over vegetation and forest ground at approximately 1–2 m intervals to collect questing ticks. The cloths were examined every 10–20 meters for ticks, which were removed using fine-tipped forceps and immediately transferred into 1.5 mL labeled cryotubes. All cryotubes were labeled with site name, date, and sample ID, and stored at -20°C upon return from the field. Tick dragging was conducted across all designated sampling sites, covering varied microhabitats such as forest edges, grass clearings, and animal trails.
Tick collection from domestic animals: Additional ticks were collected from cows with the assistance of their owners. Ticks were removed by hand and stored in labeled tubes at -20°C.
Small mammal trapping for ectoparasite collection: Sherman traps were used to capture rodents for ectoparasite collection, with a particular focus on ticks and mites. A total of 30 traps were deployed with oat rice baited in strategic locations, including along streams, forest trails, and rice fields, particularly in areas close to livestock and human dwellings, where the likelihood of rodent activity and ectoparasite presence was higher. Captured small mammals were examined for ectoparasites using fine forceps. Collected ectoparasites were stored in labeled 1.5 mL cryotubes and kept at -20°C. Additional ectoparasites were also collected from chicken nets using white paper sheets.
All samples were transported to the IPL laboratory in Vientiane on dry ice.
Climate data monitoring
The temperature and humidity data were monitored. A HOBO pro v2 data logger was used. Regional climate and land surface data were retrieved from the Japan Aerospace Exploration Agency (JAXA) Earth Observation datasets. Land use and ecological parameters were documented through direct field observation and GIS mapping.
Laboratory screening for pathogens
Individual ticks and ectoparasites were processed separately. Each specimen was placed in a 1.5 mL vial containing 1 mL of cold 1X Phosphate Buffered Saline (PBS) and Lysing Matrix A beads (MP Biomedicals). Homogenization was performed using a TissueLyser II (Qiagen) for 10 minutes. The homogenate was then centrifuged at 3000 rpm for 5 minutes. A 100 µL aliquot was used for total nucleic acid (DNA and RNA) extraction with the NucleoSpin® 8 Virus kit, following the manufacturer’s instructions. The remaining 400 µl was stored at –80°C for future pathogen isolation.
Pathogen detection were performed using classical PCR methods for selected viruses and bacteria, including:
- Arboviruses: Phleboviruses, including Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), and Flaviviruses, including Tick-Borne Encephalitis Virus
- Bacteria: Rickettsia spp. (spotted fever group bacteria), Anaplasma spp. and others.
Vector collection in 2024 – 2025
A total of 2,211 ectoparasite specimens were collected from three field missions conducted in Khua District, Phongsaly Province, between January and August 2025 (Table 2). Among these, 1,266 were collected from animals, 297 by dragging, 490 from white sheet papers, 148 from rodent trapping, and 10 from bed bedroom. Most specimens were ticks from the family Ixodidae, followed by mites (Dermanyssidae and Laelapidae) and a smaller proportion of Pulicidae (fleas) and Cimicidae (bedbugs) (Tab. 13).
Regarding tick samples, the temporal distribution showed that tick abundance was highest in May (684 samples), followed by February (595) and August (257) (Fig. 13). This may suggest a seasonal influence on tick activity, with higher density during the early rainy season.
Table 13: Sample collection between January 2024 and August 2025.
Common name | Family | Method of collection |
| ||||
Animal | Dragging | Trapping | Direct | White sheet paper | Grand Total | ||
Bed bugs | Cimicidae | 10 | 10 | ||||
Chiken mites | Dermanyssidae | 490 | 490 | ||||
Ticks | Ixodidae | 1,233 | 297 | 6 | 1,536 | ||
Rat mites | Laelapidae | 142 | 142 | ||||
Fleas | Pulicidae | 33 | 33 | ||||
| Grand Total | 1,266 | 297 | 148 | 10 | 490 | 2,211 |
Figure 13: Data of monthly rainfall from JAXA (green line) and total numbers of ticks from three field missions (columns) by collection methods.
Sample preparation and pathogen screening at IPL
A total of 898 tick samples were pooled into 74 bigpools for arbovirus screening by RT-PCR. These pools were derived from ticks collected from animals (n = 713), drag collections (n = 160), and trapped rodents (n = 25). No Flavivirus or Phlebovirus RNA was detected in any of the pools (Tab. 14).
Tab 14: Total number of tick samples screened for flaviviruses and phleboviruses by RT-PCR between January 2024 and August 2025.
Row Labels | A total No. of Pools (No. of sample) | Pan-Flavivirus Positive | Pan-Phlebo Positive | |
Animal | 66 (713) | 0 | 0 | |
Dragging | 6 (160) | 0 | 0 | |
Trapping | 2 (25) | 0 | 0 | |
Grand Total | 74 (898) | 0 | 0 |
A total of 275 tick minipools (536 samples) were screened using pan-bacteria PCR assays targeting Rickettsia and Ehrlichia spp. For pan-Rickettsia, 125/275 minipools tested positive, including 124 positive pools from animal-derived samples, and one from trapping (Tab. 15). For pan-Ehrlichia, 17/213 minipools tested positive. All positive pools were ticks collected from animals (Tab. 16).
Tab 15: Total number of tick samples screened for Rickettsia spp. by qPCR between January 2024 and August 2025.
Methods of collection | A total No. of Sample Tested | Rickettsia Positive | ||
A total No. of Pools | A total No. of Ticks | A total No. of Pools | A total No. of Ticks | |
Animal | 227 | 438 | 124 | 125 |
Dragging | 23 | 73 | 0 | 0 |
Trapping | 7 | 25 | 1 | 1 |
Grand Total | 257 | 536 | 125 | 126 |
Table 16: Total number of tick samples screened for Rickettsia spp. by qPCR between January 2024 and August 2025.
| A total No. of Sample Tested | Ehrlichia Positive | ||
Row Labels | A total No. of Pools | A total No. of Ticks | A total No. of Pools | A total No. of Tick |
Animal | 168 | 378 | 17 | 17 |
Dragging | 38 | 160 | 0 | 0 |
Trapping | 7 | 25 | 0 | 0 |
Total | 213 | 563 | 17 | 17 |
Positive pools were selected and subjected to gene-specific PCRs targeting 17kDa, ompA, and sca4 genes and Sanger sequencing for Rickettsia classification.
- R. microplus ticks showed consistent amplification across all targets (17kDa: 34/35; sca4: 32/34; ompA: 27/34).
- Ixodes ticks and R. haemaphysaloides ticks were positive for all three genes (1/1 for each).
- Fleas (unidentified species) also tested positive in smaller numbers (3/3 for 17kDa, 2/3 for sca4, and 1/3 for ompA).
A total of 17 Ehrlichia-positive tick samples (R. microplus) were successfully amplified gltA and/or groEL gene targets (gltA: 14/17; groEL: 17/17).
Discussion and Perspectives
The ectoparasite surveillance conducted in Khua District, Phongsaly Province, between January and August 2025 provides valuable baseline data on vector diversity and pathogen circulation in northern Laos. The majority of collected specimens belonged to the family Ixodidae, reflecting the high abundance of ticks in this mountainous and forested region where animal–human interactions are frequent. The temporal distribution of ticks, peaking in May and declining in August, suggests a clear seasonal pattern likely influenced by temperature and humidity during the early rainy season. This finding highlights the importance of incorporating climate and ecological variables into future vector surveillance and predictive modeling.
Although no Flavivirus or Phlebovirus RNA was detected in the screened tick pools, the high detection rate of Rickettsia spp. (45%) and moderate positivity for Ehrlichia spp. indicate the presence of bacteria of potential public health importance. The consistent amplification of Rickettsia genes (17kDa, ompA, and sca4) in Rhipicephalus microplus and Ixodes ticks underscores their possible role as vectors in local transmission cycles. The detection of Ehrlichia DNA further supports the need for integrated surveillance covering both animal and human populations.
The development of the Knowledge, Attitudes, and Practices (KAP) survey protocol marks an important step toward understanding local perceptions of tick-borne diseases and climate change impacts. Combined with pathogen and vector data, the forthcoming human component will help inform community-based prevention strategies.
Overall, this integrated approach strengthens local capacity for surveillance and provides a foundation for long-term monitoring of climate-sensitive vector-borne diseases in Laos.
Our ongoing NGS-based surveillance of arthropod vectors in Laos has revealed a broad diversity of viruses across multiple taxa. In ticks, analysis of 161 samples (3,116 individuals) collected between 2019 and 2025 identified more than 127 virus families. Differences in Shannon diversity indices among ticks of the same genus suggest that ecological conditions, host preferences, and collection sources may influence virus diversity. Notably, several virus families of interest were detected and need more in-depth analysis, including Chuviridae, Phenuiviridae, Rhabdoviridae, Flaviviridae, and Orthomyxoviridae.
Among mosquito-derived libraries (n = 37), 13 complete flavivirus CDSs were recovered. One was phylogenetically related to known mosquito-borne flaviviruses, while the remaining twelve clustered within insect-specific flaviviruses, indicating extensive virus diversification within local mosquito populations. In sandflies, nine additional complete phlebovirus CDSs were obtained between 2024 and 2025, all clustering with the previously described Laotian phlebovirus 1 (LPV1), confirming its continued circulation in northern Laos.
Together, these findings provide an updated overview of the virome landscape in hematophagous arthropods of Laos. Continued analysis of the remaining samples and integration of the data generated with ecological and climatic data will be essential for assessing virus–vector–environment interactions and enhancing early detection of emerging vector-borne pathogens in the region.
